Version Compatibility
Reference examples tested with: cutadapt 4.4+, miRge3.0 0.1.4+, miRDeep2 2.0.1.3+, DESeq2 1.42+, apeglm 1.24+, miRanda 3.3a, umi_tools 1.1+, miRTrace 1.0+
Before using code patterns, verify installed versions match. If versions differ:
- R:
packageVersion('<pkg>') then ?function_name to verify parameters
- CLI:
<tool> --version then <tool> --help to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
Note: the correct 3' adapter sequence and the UMI/4N scheme are KIT-specific (TruSeq vs NEXTflex vs QIAseq) — confirm against the kit before trimming. The normalizer that best fits compositional miRNA data drifts with the method literature; treat the table below as a decision aid to validate, not a fixed rule.
Small RNA-seq Pipeline
"Analyze my small RNA-seq data from FASTQ to differential miRNAs" -> Chain kit-aware trimming, known-miRNA quantification (or novel discovery), a compositionally-aware DE test, and expression-filtered target prediction.
- CLI + R: cutadapt -> (miRge3.0 | miRDeep2) -> DESeq2 (inspect size factors) -> miRanda (filter by anti-correlated mRNA)
This is a workflow skill: it owns the chaining decisions and hand-offs, not the internals of any one step. Every step below cross-references the component skill that teaches its mechanism.
The governing principle
A small RNA-seq result turns on two things the mRNA pipeline never faces — the adapter is on every read, and the counts are compositional — so the trustworthy result is decided at these seams.
- The library kit fixes adapter + UMI/4N handling, committed once at trimming and un-reversible. The insert (~22 nt) is far shorter than the read, so the 3' adapter is on EVERY real read and
--discard-untrimmed correctly drops no-insert junk (the inverse of genomic DNA). NEXTflex 4N random bases are stripped AFTER adapter removal; QIAseq UMIs are extracted and deduped. NEVER position-dedup a non-UMI small-RNA library — abundant miRNAs legitimately share start positions, so position-dedup destroys real signal.
- The normalizer is the dominant analytic commitment — more than the DE model. miRNA counts are few-featured and compositional; a handful of miRNAs can dominate the library. Global scaling (TMM's 30%/5% trimming, median-of-ratios) is built for ~20k mRNAs and is harmful among hundreds of miRNAs (Garmire 2012). The normalizer choice CHANGES which miRNAs are called DE. Commit and report it; do not default silently.
- RAW counts (not RPM) flow into DESeq2, and size factors must be inspected. A large rise in one abundant miRNA mechanically deflates all others (the closed-composition artifact), manufacturing spurious "down" calls. Confirm the input is raw integer counts and inspect
sizeFactors(dds) before trusting any call.
- Targets are hypotheses, not findings. miRanda output must be intersected with anti-correlated mRNA DE and validated databases before interpretation.
Pipeline map
FASTQ (single-end small RNA)
| [1] Trim (kit-aware) --------> cutadapt (+ umi_tools / 4N) (small-rna-seq/smrna-preprocessing)
v ^-- commitment: kit adapter + UMI/4N; --discard-untrimmed; NO position-dedup w/o UMI
| [2] Quantify OR discover ----> miRge3.0 (known+isomiR) | miRDeep2 (novel) (small-rna-seq/mirge3-analysis, mirdeep2-analysis)
v
| [3] Differential expression -> DESeq2 on RAW counts; INSPECT size factors (small-rna-seq/differential-mirna)
v ^-- commitment: the NORMALIZER (drives which miRNAs are DE)
| [4] Target prediction -------> miRanda, filtered by anti-correlated mRNA DE (small-rna-seq/target-prediction)
v
Differential miRNAs + expression-supported targets
(tRF/piRNA reads -> small-rna-seq/trf-pirna-profiling)
Made-once commitments
| Commitment |
Choice |
Consequence inherited downstream |
| Library kit adapter + UMI/4N |
TruSeq / NEXTflex-4N / QIAseq-UMI handling, set at trimming |
Wrong adapter or missed 4N/UMI corrupts every count; non-UMI position-dedup destroys real miRNAs |
| Quantification target |
Known-miRNA + isomiR (miRge3) vs novel discovery (miRDeep2) |
Discovery is high-FP and needs a genome + bowtie1; quantification is the common curated case |
| Normalizer |
median-of-ratios/TMM vs quantile/loess vs RUVg vs CoDA/ALDEx2 |
Which miRNAs are DE (more than the DE model choice) |
| Biofluid vs tissue |
plasma/serum has NO trustworthy endogenous normalizer |
DE may be uninterpretable without spike-ins + hemolysis modeling |
The canonical order and why
- Trim (kit-aware) — adapter removal with
--discard-untrimmed; 4N/UMI handling before or during collapse. Order-trap: position-deduping a non-UMI library removes real high-abundance miRNAs.
- miRTrace QC — length/complexity, RNA-class composition, cross-clade contamination BEFORE quantification (a good mapping rate hides sample swaps and reagent contamination).
- Quantify (miRge3) or discover (miRDeep2) — to raw integer counts. For miRDeep2, choose the score cutoff from
survey.pl signal-to-noise, not a fixed rule.
- Low-count filter (
rowSums >= 10, lower than mRNA) BEFORE normalization.
- DE with the committed normalizer — raw counts into DESeq2; inspect
sizeFactors. Order-trap: feeding RPM/CPM bakes compositional distortion into an invalid model.
- Target prediction — intersect miRanda predictions with anti-correlated mRNA DE (order-trap: enrichment on raw predictions is false-positive-laden).
Fork/decision points
Pipeline-level selection only; mechanism lives in the component skills.
| Fork |
Lean toward |
Hand off to |
| Quantify vs discover |
miRge3.0 (known + isomiR, curated, common) vs miRDeep2 (novel only; high FP, genome + bowtie1, survey.pl cutoff) |
small-rna-seq/mirge3-analysis, small-rna-seq/mirdeep2-analysis |
| Normalizer |
median-of-ratios/TMM (risky under composition shift) vs quantile/loess (better on skewed miRNA) vs RUVg (control/empirical miRNAs) vs CoDA/ALDEx2 (compositional sensitivity check) |
small-rna-seq/differential-mirna |
| Biofluid/plasma |
no trustworthy endogenous normalizer (miR-16 is hemolysis-sensitive, U6 degrades); cel-miR-39 spike controls EXTRACTION not biological scale; model batch/hemolysis explicitly |
small-rna-seq/differential-mirna |
| RNA class |
miRNA vs tRF/piRNA (26-32 nt peak) -> route to trf-pirna-profiling (MINTmap/unitas) |
small-rna-seq/trf-pirna-profiling |
Primary path: cutadapt -> miRge3.0 -> DESeq2 -> miRanda
Goal: turn kit-specific FASTQ into differential miRNAs with expression-supported targets.
Approach: trim to the kit, quantify known miRNAs/isomiRs, test RAW counts with size-factor inspection, then filter targets by anti-correlation. (The runnable script in examples/ shows the miRDeep2 novel-discovery route below; the miRge3.0 commands are shown here.)
# Kit-aware trim: adapter on EVERY read, so --discard-untrimmed drops no-insert junk (inverse of gDNA).
# NEXTflex 4N: cutadapt -u 4 -u -4 AFTER adapter. QIAseq UMIs: umi_tools. NEVER position-dedup non-UMI.
cutadapt -a TGGAATTCTCGGGTGCCAAGG --minimum-length 18 --maximum-length 30 --discard-untrimmed \
-o trimmed.fastq.gz reads.fastq.gz
# Known-miRNA + isomiR quantification (the common case). NOTE: v3 has NO 'annotate' subcommand
# (that was miRge2); it is `miRge3.0 -s ...`. Reads are already cutadapt-trimmed, so -a is OMITTED
# (v3 has no 'none' keyword; passing one makes cutadapt treat it as an adapter sequence and fail).
# isomiRs are annotated by default; -gff emits the isomiR GFF.
# (-ai would instead compute A-to-I editing, a separate analysis, not isomiR reporting.)
miRge3.0 -s trimmed.fastq.gz -lib /path/to/miRge3_Lib -on human -db mirbase \
-gff -cpu 8 -o mirge_out
library(DESeq2)
# RAW counts (miR.Counts.csv), NOT RPM. A few miRNAs can dominate, so inspect sizeFactors first.
# miRge3.0 writes into a timestamped subfolder (mirge_out/miRge.YYYY-M-D_h-m-s/), not directly into -o
counts <- read.csv(Sys.glob('mirge_out/miRge.*/miR.Counts.csv')[1], row.names = 1)
dds <- DESeqDataSetFromMatrix(round(counts), colData, ~condition)
dds <- dds[rowSums(counts(dds)) >= 10, ] # lower prefilter than mRNA
dds <- DESeq(dds)
print(sizeFactors(dds)) # a dominant-miRNA shift distorts these -> spurious calls
res <- lfcShrink(dds, coef = 'condition_treated_vs_control', type = 'apeglm')
# Targets are a hypothesis: intersect with anti-correlated mRNA DE before trusting them.
# -sc 140: miRanda default alignment-score floor; -en -20: keep duplexes with MFE <= -20 kcal/mol (stable binding)
miranda mature_mirnas.fa target_3utrs.fa -sc 140 -en -20 -strict -out targets.txt
Novel discovery alternative: miRDeep2
Goal: discover previously unannotated miRNAs (only when that is the question).
Approach: collapse reads, map to the genome with bowtie1, run miRDeep2, and pick the score cutoff from the signal-to-noise survey — not a fixed threshold. Full runnable script: examples/smrnafullpipeline.sh.
gunzip -kc trimmed.fastq.gz > trimmed.fastq # mapper.pl reads plain-text FASTQ, not gzip
mapper.pl trimmed.fastq -e -h -i -j -l 18 -m -p genome_index \
-s reads_collapsed.fa -t reads_collapsed_vs_genome.arf
miRDeep2.pl reads_collapsed.fa genome.fa reads_collapsed_vs_genome.arf \
mature_ref.fa none hairpin_ref.fa -t Human # score cutoff from survey.pl signal-to-noise
QC checkpoints between steps
| After |
Gate |
Interpretation |
| Trim |
Read-length peak 21-23 nt |
30+ nt smear = degradation/tRNA/rRNA; 26-32 nt peak = piRNA (route to trf-pirna-profiling) |
| miRTrace/align |
RNA-class composition (miRNA vs tRF/rRF/piRNA); cross-clade contamination |
Abundant non-miRNA classes mean this is a tRF/piRNA story, not a miRNA one |
| Before DE |
RAW counts (not RPM); size factors inspected |
A dominant-miRNA shift distorts size factors and manufactures spurious "down" calls |
| After DE |
baseMean reported with every call |
A significant fold-change on a ~5-count miRNA is noise |
| Targets |
filtered by anti-correlated mRNA DE + validated DBs |
Raw miRanda predictions are hypotheses, not findings |
Ligation bias means absolute cross-miRNA abundance WITHIN a sample is untrustworthy; compare the same miRNA across samples, never across kits. For a fully reproducible run, nf-core/smrnaseq chains these steps (workflow-management/nf-core-pipelines).
Common Errors
| Symptom |
Cause |
Fix |
| Real high-abundance miRNAs vanish |
Position-deduped a non-UMI library |
Dedup ONLY with UMIs (umi_tools); non-UMI libraries are not position-deduped |
| Invalid model / distorted calls |
Fed RPM/CPM to DESeq2 |
Use RAW integer counts; RPM bakes in composition |
| Many spurious "down" miRNAs |
One abundant miRNA rose and deflated the rest (closed composition) |
Inspect size factors; consider quantile/RUVg/ALDEx2 as a sensitivity check |
| DE looks strong but is noise |
Fold-change on a ~5-count miRNA |
Report and gate on baseMean |
| Plasma miRNA DE uninterpretable |
No trustworthy endogenous normalizer; hemolysis confound |
Spike-ins for extraction control + model hemolysis/batch explicitly |
| "miRNA" library is mostly tRF/piRNA |
26-32 nt peak / broad tRF distribution |
Route to trf-pirna-profiling (MINTmap/unitas) |
Pipeline map (hand-offs)
- small-rna-seq/smrna-preprocessing - kit-specific adapter, UMI, and 4N handling
- small-rna-seq/mirge3-analysis - known-miRNA and isomiR quantification
- small-rna-seq/mirdeep2-analysis - novel miRNA discovery and survey.pl cutoff
- small-rna-seq/differential-mirna - compositionally-aware DE and normalizer selection
- small-rna-seq/target-prediction - seed prediction filtered by expression
- small-rna-seq/trf-pirna-profiling - tRF and piRNA profiling
The runnable miRDeep2 discovery-route script is in this skill's examples/ (smrnafullpipeline.sh).
Related Skills
- small-rna-seq/smrna-preprocessing - Kit-specific adapter, UMI, and 4N handling
- small-rna-seq/mirdeep2-analysis - Novel miRNA discovery
- small-rna-seq/mirge3-analysis - Known-miRNA and isomiR quantification
- small-rna-seq/differential-mirna - Compositionally-aware DE
- small-rna-seq/target-prediction - Seed prediction filtered by expression
- small-rna-seq/trf-pirna-profiling - tRF and piRNA profiling
- differential-expression/deseq2-basics - DESeq2 model, contrasts, shrinkage
- workflow-management/nf-core-pipelines - Run nf-core/smrnaseq as a curated, reproducible pipeline
References
- Garmire LX, Subramaniam S (2012) Evaluation of normalization methods in mammalian microRNA-Seq data. RNA 18:1279-1288. DOI 10.1261/rna.030916.111. (normalization, not the DE model, drives miRNA DE results.)
- Risso D, Ngai J, Speed TP, Dudoit S (2014) Normalization of RNA-seq data using factor analysis of control genes or samples. Nature Biotechnology 32:896-902. DOI 10.1038/nbt.2931. (RUVg for miRNA/unwanted variation.)
- Friedländer MR, Mackowiak SD, Li N, Chen W, Rajewsky N (2012) miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic Acids Research 40:37-52. DOI 10.1093/nar/gkr688.