smithery.ai

bio-reverse-complement

Generate reverse complements and complements of DNA/RNA sequences using Biopython, including IUPAC ambiguity codes, gapped alignments, and minus-strand features.

First seen Mar 26, 2026

Installation

$ npx skills add https://smithery.ai

Summary

  • Generate reverse complements and complements of DNA/RNA sequences using Biopython, including IUPAC ambiguity codes, gapped alignments, and minus-strand features.
  • Use when working with the opposite strand, building reverse primers, normalizing strand orientation before alignment, or extracting a coding sequence from a minus-strand feature.

Similar popular skills

Related neighbors and high-traction skills in the same topics — useful to compare before installing.

Also in this package

Other skills from smithery.ai · top by installs.

npx skills add https://smithery.ai

Browse all from smithery.ai

More details

Agent compatibility

Declared targets from SKILL.md / docs. Unmarked agents are not listed — the skill may still install via the CLI.

Claude Code Not declared
Cursor Not declared
Codex Not declared
GitHub Copilot Not declared
Windsurf Not declared
Gemini CLI Not declared
Cline Not declared
OpenCode Not declared

Package contents

Files included with this skill beyond the listing page.

  • skill md SKILL.md 11,031 B
  • docs SUMMARY.md 218 B

History

  1. First seen on skills.sh
  2. First recorded snapshot · 1 installs

SKILL.md

Version Compatibility

Reference examples tested with: BioPython 1.83+

Before using code patterns, verify installed versions match. If versions differ:

  • Python: pip show <package> then help(module.function) to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

Reverse Complement

Generate complementary and reverse complementary sequences using Biopython.

"Get the reverse complement" -> Produce the 5'-to-3' sequence of the opposite strand.

  • Python: seq.reverse_complement() (BioPython Seq)
  • CLI: samtools faidx ref.fa region --reverse-complement (extracts and RCs a region)

The Governing Principle

Never hand-roll the complement table. Biopython's reversecomplement() already encodes the full IUPAC mapping correctly, case-insensitively, and on minus-strand features it is applied for the analyst automatically by SeqFeature.extract(). Every silent corruption in this domain comes from reimplementing what Biopython already does right: swapping ambiguity codes, forgetting that S/W/N are self-complementary, complementing the wrong molecule type, or reverse-complementing a second time after extract() already did it. Reach for the library method; reach for a guard (moleculetype) before it; never reach for a custom dictionary.

Required Import

from Bio.Seq import Seq

Which Method for Which Question

Question Method Output strand/direction
Opposite strand, conventional 5'->3' reverse_complement() 5'->3' of the complementary strand (the usual answer)
Base-paired sequence, same direction complement() 3'->5' of the complementary strand
Opposite strand of RNA, keep U reversecomplementrna() 5'->3', emits U
Complement of RNA, keep U complement_rna() 3'->5', emits U
Coding strand from template (or vice versa) reverse_complement() the other strand, 5'->3'
mRNA sequence from the coding strand transcribe() (NOT a complement) same strand, T->U

reverse_complement()

Returns the reverse complement (5'->3' of the opposite strand). This is the most commonly used operation.

seq = Seq('ATGCGATCG')
rc = seq.reverse_complement()  # Returns Seq('CGATCGCAT')

complement()

Returns the complement without reversing. Less common - gives the opposite strand still written in 3'->5' order.

seq = Seq('ATGCGATCG')
comp = seq.complement()  # Returns Seq('TACGCTAGC')

reversecomplementrna() and complement_rna()

For RNA, the dedicated methods emit U:

rna = Seq('AUGCGAUCG')
rna.reverse_complement_rna()  # Returns Seq('CGAUCGCAU')
rna.complement_rna()          # Returns Seq('UACGCUAGC')

Base Pairing and Ambiguity Codes

reverse_complement() complements all 15 IUPAC codes plus X correctly. The mapping is non-obvious for ambiguity codes - this is exactly why hand-rolling corrupts silently.

| Code | Bases | Complement | | Code | Bases | Complement | |------|-------|------------|-|------|-------|------------| | A | A | T | | M | A/C | K | | T | T | A | | B | C/G/T | V | | G | G | C | | V | A/C/G | B | | C | C | G | | D | A/G/T | H | | R | A/G | Y | | H | A/C/T | D | | Y | C/T | R | | S | G/C | S (self) | | K | G/T | M | | W | A/T | W (self) | | | | | | N | any | N (self) |

S, W, N, and X are SELF-complementary. The pairs that get swapped wrong by hand are B<->V and D<->H. The table is built for upper and lower case, so complementation is case-insensitive (Seq('atRY').reverse_complement() works).

DNA vs RNA: the U handling rule

reverse_complement() runs in DNA mode: it treats any U as a T and EMITS T (docstring: "Any U in the sequence is treated as a T"). It does not raise and does not leave U.

Seq('ACGU').reverse_complement()      # Returns Seq('ACGT')  -- U mapped to A, emitted as T
Seq('ACGU').reverse_complement_rna()  # Returns Seq('ACGU')  -- stays RNA

transcribe() does NOT complement. It swaps T->U on the SAME strand. Confusing "complement the template" with "transcribe the coding strand" is silent corruption. True biological transcription from the template strand is templatedna.reversecomplement().transcribe().

Gaps and Non-Table Characters

complement and reverse_complement do NOT validate the alphabet (unlike translate()). A gap - is not a table key, so it passes through unchanged and reversal preserves gap columns - the desired behavior for aligned sequences. Any other non-table character (?, *) also passes through silently.

Seq('ATG-CGA--TY').reverse_complement()  # Returns Seq('RA--TCG-CAT') -- gaps preserved, Y->R

Because there is no alphabet check, garbage in produces garbage out without a warning (see the protein trap below).

Code Patterns

Visualize Double-Stranded DNA

def show_dsdna(seq):
    print(f"5'-{seq}-3'")
    print(f"   {'|' * len(seq)}")
    print(f"3'-{seq.complement()}-5'")

show_dsdna(Seq('ATGCGATCG'))

Check if a Sequence is Palindromic (Self-Complementary)

def is_palindrome(seq):
    return seq == seq.reverse_complement()

is_palindrome(Seq('GAATTC'))  # True  -- EcoRI site
is_palindrome(Seq('ATGCGA'))  # False

Reverse Complement a FASTA File

Goal: Produce a new FASTA file with all sequences reverse-complemented.

Approach: Parse records as a stream, build new SeqRecords from .reverse_complement(), write to output.

Reference (BioPython 1.83+):

from Bio import SeqIO
from Bio.SeqRecord import SeqRecord

def reverse_complement_records(records):
    for record in records:
        yield SeqRecord(record.seq.reverse_complement(), id=record.id + '_rc', description=record.description + ' reverse complement')

records = SeqIO.parse('sequences.fasta', 'fasta')
SeqIO.write(reverse_complement_records(records), 'sequences_rc.fasta', 'fasta')

Extract a Coding Sequence from a Minus-Strand Feature

Goal: Get the correct 5'->3' coding sequence for a gene annotated on the minus strand.

Approach: Call feature.extract(parent.seq). For strand == -1, extract() ALREADY reverse-complements the slice and returns the coding sequence. Do NOT reverse-complement again.

Reference (BioPython 1.83+):

from Bio.Seq import Seq
from Bio.SeqFeature import SeqFeature, SimpleLocation

parent = Seq('AAATGGGCCCTTTAAA')
feature = SeqFeature(SimpleLocation(3, 12, strand=-1), type='CDS')
cds = feature.extract(parent)  # Already reverse-complemented; this is the coding sequence
# cds.reverse_complement()     # WRONG -- double-RC bug, valid-looking but wrong strand

Search Both Strands for a Motif

Goal: Find a motif on both strands and report forward-strand coordinates.

Approach: Search the forward sequence, then search its reverse complement, mapping minus-strand hits back to forward coordinates.

Reference (BioPython 1.83+):

def search_both_strands(seq, motif):
    motif = Seq(motif)
    results = []
    pos = seq.find(motif)
    while pos != -1:
        results.append(('+', pos))
        pos = seq.find(motif, pos + 1)
    rc = seq.reverse_complement()
    pos = rc.find(motif)
    while pos != -1:
        results.append(('-', len(seq) - pos - len(motif)))
        pos = rc.find(motif, pos + 1)
    return results

search_both_strands(Seq('ATGCGAATTCGATGAATTCGATC'), 'GAATTC')

In-Place Complementation

inplace defaults to False (standardized in 1.79). On an immutable Seq, inplace=True raises TypeError: Sequence is immutable (a loud, useful error). In-place mutation works only on MutableSeq.

from Bio.Seq import MutableSeq
m = MutableSeq('ATGC')
m.reverse_complement(inplace=True)  # m is now MutableSeq('GCAT')

The Protein Trap

Since the 1.78 alphabet removal there is no molecule-type checking. Reverse-complementing a protein produces SILENT GARBAGE with no warning: residues that are also nucleotide codes get complemented (Seq('MAIVMGR').reverse_complement() -> Seq('YCKBITK'); M->K, V->B), while protein-only letters E, F, I, L, P, Q, Z and * pass through unchanged. The old IUPAC.protein ValueError guard is gone. Guard on the molecule type, not the Seq:

if record.annotations.get('molecule_type') not in ('DNA', 'RNA'):
    raise ValueError('reverse_complement is only valid for nucleotide sequences')

Common Errors

Symptom Cause Fix
U replaced by T in result reverse_complement() runs in DNA mode (U treated as T) Use reversecomplementrna() to keep RNA
Result is meaningless letters, no error Reverse-complemented a protein (silent since 1.78) Guard on molecule_type, not the Seq
Coding sequence is the wrong strand Called .reverse_complement() after extract() on a minus-strand feature extract() already RC'd it; do not RC again
TypeError: Sequence is immutable inplace=True on a Seq Use a MutableSeq, or take the returned value
Ambiguity codes complement wrongly Hand-rolled complement table (B/V, D/H swapped; S/W/N not self-complementary) Use Biopython's reverse_complement(); never reinvent the table
Same strand returned instead of complement Used transcribe() thinking it complements transcribe() only swaps T->U; use reverse_complement() for the other strand
TypeError on a plain string Passed a str instead of a Seq Wrap input in Seq() first

References

Cornish-Bowden A (1985) "Nomenclature for incompletely specified bases in nucleic acid sequences: recommendations 1984." Nucleic Acids Res 13(9):3021-3030 (PMID 2582368). Defines the IUPAC ambiguity codes (R, Y, S, W, K, M, B, D, H, V, N) that Biopython's complement table implements.

Related Skills

  • seq-objects - Create and mutate Seq/MutableSeq objects to complement
  • transcription-translation - transcribe() vs complement(); six-frame translation uses the reverse complement
  • motif-search - Search both strands by reverse-complementing the query or sequence
  • sequence-io/read-sequences - Parse FASTA/GenBank records before reverse-complementing
  • primer-design/primer-basics - Reverse primers are the reverse complement of the target 3' end
  • restriction-analysis/restriction-sites - Restriction sites are often palindromic (self-complementary)
  • alignment-files/sam-bam-basics - BAM FLAG indicates read strand; samtools view -f 16 selects reverse reads