smithery.ai

bio-read-qc-adapter-trimming

Removes sequencing adapters from FASTQ reads with Cutadapt and Trimmomatic, including paired-end read-through, small-RNA 3' adapters, amplicon primers, and anchored/linked adapters.

First seen Apr 17, 2026

Installation

$ npx skills add https://smithery.ai

Summary

  • Removes sequencing adapters from FASTQ reads with Cutadapt and Trimmomatic, including paired-end read-through, small-RNA 3' adapters, amplicon primers, and anchored/linked adapters.
  • Use when FastQC shows adapter content climbing toward the 3' end, when inserts are shorter than the read length (small-RNA, cfDNA, FFPE), or before assembly/k-mer analysis.
  • For all-in-one trimming use fastp-workflow; for quality/length filtering use quality-filtering.

Similar popular skills

Related neighbors and high-traction skills in the same topics — useful to compare before installing.

Also in this package

Other skills from smithery.ai · top by installs.

npx skills add https://smithery.ai

Browse all from smithery.ai

More details

Agent compatibility

Declared targets from SKILL.md / docs. Unmarked agents are not listed — the skill may still install via the CLI.

Claude Code Not declared
Cursor Not declared
Codex Not declared
GitHub Copilot Not declared
Windsurf Not declared
Gemini CLI Not declared
Cline Not declared
OpenCode Not declared

Package contents

Files included with this skill beyond the listing page.

  • skill md SKILL.md 11,618 B
  • docs SUMMARY.md 289 B

History

  1. First seen on skills.sh
  2. First recorded snapshot · 1 installs

SKILL.md

Version Compatibility

Reference examples tested with: Cutadapt 4.4+, Trimmomatic 0.39+, fastp 0.23+, FastQC 0.12+

Before using code patterns, verify installed versions match. If versions differ:

  • CLI: <tool> --version then <tool> --help to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

Adapter Trimming -- adapter content IS the insert-size distribution

Remove adapter sequence that the polymerase read INTO once it ran off the end of a short insert, using Cutadapt (precise, the correctness reference) or Trimmomatic (palindrome mode for paired read-through).

"Trim adapters from my reads" -> Detect and remove 3' adapter introduced by read-through, then length-filter the survivors.

  • CLI: cutadapt -a AGATCGGAAGAGC -A AGATCGGAAGAGC -m 20 -o R1.fq -p R2.fq inR1.fq inR2.fq
  • All-in-one alternative: fastp (PE overlap analysis needs no adapter sequence) -> read-qc/fastp-workflow

Scope: this skill OWNS adapter/primer removal. Quality and length filtering -> read-qc/quality-filtering. Single-pass trim+QC -> read-qc/fastp-workflow. Contaminant/PhiX k-mer removal -> read-qc/contamination-screening. OUT OF SCOPE: quality-score trimming as a standalone goal (usually unnecessary before soft-clipping aligners; see insight 2).

The Single Most Important Modern Insight

  1. Adapter appears only when the insert is shorter than the read, so adapter content is a direct readout of the insert-size distribution -- and adapter trimming is 3'-only for standard Illumina. The library is [P5]-[insert]-[P7]; a read primes at the insert boundary and reads 5'->3' into the insert, running into the 3'/P7-side adapter only if it runs out of insert. Short-insert libraries (small-RNA ~22 nt, cfDNA ~167 bp, FFPE, degraded RNA, ancient DNA) are read-through-dominated; long-insert WGS may show almost none. The FastQC adapter-content curve climbing toward the 3' end IS that insert-size signal.
  1. Adapter trimming is the one near-universal preprocessing step; quality trimming usually is not. Local aligners (BWA-MEM, STAR, Bowtie2 local, HISAT2) SOFT-CLIP low-quality tails, so quality trimming is redundant or harmful for alignment-based DNA/RNA (MacManes 2014, Williams 2016; GATK discourages it before BQSR). But aligners do NOT reliably remove ADAPTER -- adapter is foreign sequence with genuine base quality, so the aligner may try to align it and anchor a wrong placement. Trim adapter; leave quality trimming to the cases that need it (assembly, k-mer/pseudo-alignment, small-RNA, amplicon, no-BQSR variant calling).
  1. Small-RNA inverts the logic: the adapter is on EVERY read, so DISCARD reads with no adapter. A ~22 nt miRNA insert is far shorter than a 50-75 nt read, so read-through is universal; a read with no detectable adapter is an adapter dimer, a too-long contaminant, or junk. Use --discard-untrimmed plus a tight length gate (-m 18 -M 30). This is the OPPOSITE of genomic DNA, where the no-adapter reads are the good full-length inserts.

Two-color trap: on NextSeq/NovaSeq, a high-quality poly-G tail is NOT adapter and is not removed by adapter trimming -- it needs a chemistry-aware poly-G trim (cutadapt --nextseq-trim=20, or fastp's auto poly-G). See read-qc/quality-reports and read-qc/fastp-workflow.

Verified Adapter Sequences

Kit Read Sequence
Illumina TruSeq R1 3' AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Illumina TruSeq R2 3' AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
TruSeq (shared stem -- catches both) -- AGATCGGAAGAGC
Nextera / Tn5 transposase CTGTCTCTTATACACATCT
TruSeq small-RNA 3' TGGAATTCTCGGGTGCCAAGG

The R1 3' adapter is the reverse complement of the R2-side region; trimming the shared 13 bp stem AGATCGGAAGAGC on both mates catches TruSeq read-through.

Tool Taxonomy

Tool Mechanism When it wins
Cutadapt Error-tolerant semiglobal alignment of a supplied adapter PRECISION: small-RNA 3' adapter, amplicon/16S primers, anchored/linked adapters, demultiplexing. The correctness reference.
Trimmomatic ILLUMINACLIP simple + palindrome modes; ordered step pipeline Legacy/reproducibility pipelines; palindrome PE read-through detection
fastp PE overlap analysis (no adapter sequence needed) + auto poly-G DEFAULT general-purpose trim; one fast pass (route OUT -> fastp-workflow)
Trim Galore Cutadapt + FastQC wrapper with adapter auto-detect Bisulfite/RRBS (--rrbs), Bismark pipelines
BBDuk k-mer match against an adapter/contaminant reference Contaminant/PhiX removal in the same pass (route OUT -> contamination-screening)

Decision Tree by Scenario

Scenario Use Why
General Illumina PE WGS/WES/RNA fastp, or cutadapt with the TruSeq stem Overlap analysis needs no sequence; cutadapt for explicit control
Small-RNA / miRNA cutadapt -a TGGAATTCTCGGGTGCCAAGG -m 18 -M 30 --discard-untrimmed Adapter on every read; gate length and drop no-adapter reads
Amplicon / 16S primers cutadapt linked/anchored adapters Primers are at fixed positions; needs precise placement
PE read-through, no adapter sequence known fastp overlap, or Trimmomatic palindrome Both detect read-through from the R1/R2 overlap
Bisulfite / RRBS Trim Galore --rrbs Handles MspI fill-in and Bismark conventions
NextSeq/NovaSeq with poly-G tails fastp (auto) or cutadapt --nextseq-trim Poly-G is high-Q; quality trim alone misses it

Default when uncertain: fastp for bulk PE, cutadapt with the TruSeq stem for explicit single-tool control.

Cutadapt

The algorithm is semiglobal (overlap) alignment, so a partial 3' adapter at the read end is detected. Two defaults drive behavior: -e (error rate, default 0.1) is computed against the LENGTH OF THE MATCHED REGION, not the whole adapter (an 8 bp match with 1 error is rate 0.125 and is rejected at the default); -O (minimum overlap, default 3) costs only ~0.07 bases lost per read by chance.

# Single-end 3' adapter
cutadapt -a AGATCGGAAGAGC -m 20 -o trimmed.fq.gz in.fq.gz

# Paired-end TruSeq (shared stem on both mates); both reads of a pair are discarded together
cutadapt -a AGATCGGAAGAGC -A AGATCGGAAGAGC -m 20:20 \
         -o R1.fq.gz -p R2.fq.gz in_R1.fq.gz in_R2.fq.gz

# Small-RNA: adapter on every read -> discard untrimmed, gate length
cutadapt -a TGGAATTCTCGGGTGCCAAGG -m 18 -M 30 --discard-untrimmed -j 8 \
         -o mirna.fq.gz raw.fq.gz

# Amplicon: linked 5'...3' primers (anchor with ^ to require the 5' primer)
cutadapt -g ^FWDPRIMER...REVPRIMER -o trimmed.fq.gz in.fq.gz

# 2-color poly-G aware (treats G as low quality so high-Q poly-G is trimmed)
cutadapt --nextseq-trim=20 -a AGATCGGAAGAGC -m 20 -o out.fq.gz in.fq.gz

# Higher error tolerance / longer required overlap when matches are missed / spurious
cutadapt -a ADAPTER -e 0.15 -O 5 -m 20 -o out.fq.gz in.fq.gz

Key flags: -a/-g/-b (3'/5'/anywhere, R1), -A/-G/-B (R2), -q (quality trim, BWA running-sum, runs BEFORE adapter removal), --pair-filter {any,both,first} (default any), --max-n, --action {trim,mask,lowercase,none}. When a filtering option discards reads in PE mode, both files MUST be processed together or they fall out of sync.

Trimmomatic

ILLUMINACLIP:<adapters.fa>:<seedMismatches>:<palindromeClip>:<simpleClip>:<minAdapterLen>:<keepBothReads>

  • seedMismatches: mismatches tolerated in the initial seed (commonly 2).
  • palindromeClip (~30): log-odds threshold for the PE palindrome alignment; ~30 needs ~50 matched bases.
  • simpleClip (~10): log-odds threshold for an adapter-vs-read match; ~10 needs ~16 bases.
  • keepBothReads: DEFAULT False -- after palindrome detects read-through, R2 is redundant (reverse complement of R1) and is DROPPED; set True if a downstream tool needs both mates.

SIMPLE mode tests each adapter against each read. PALINDROME mode (PE-only) aligns R1+adapter against the reverse complement of R2+adapter, so it detects read-through even when only a few adapter bases remain or the adapter is entirely past the read end. Steps run in COMMAND-LINE ORDER; put ILLUMINACLIP first and MINLEN last so the length check reflects all prior trimming.

# Paired-end, palindrome-capable adapter file, MINLEN last
trimmomatic PE -phred33 -threads 8 \
    in_R1.fq.gz in_R2.fq.gz \
    R1_paired.fq.gz R1_unpaired.fq.gz R2_paired.fq.gz R2_unpaired.fq.gz \
    ILLUMINACLIP:TruSeq3-PE-2.fa:2:30:10:2:keepBothReads MINLEN:36

# Built-in adapter files ship with the install
ls $CONDA_PREFIX/share/trimmomatic-*/adapters/

PE mode emits FOUR files: paired (both mates survived) and unpaired/orphan (mate dropped). Feed the paired files to the aligner; the orphans stay synchronized out of the way.

Common Errors

Symptom Cause Solution
FastQC still shows adapter after trimming Wrong adapter, too-low -e, or only partial stem used Use the shared stem AGATCGGAAGAGC; raise -e to 0.15; BLAST the overrepresented sequence
Reads truncated / many lose a few bp -O too low -> random 3-mer matches Raise -O (e.g. 5); the default loses ~0.07 bp/read by chance
Aligner reports R1/R2 out of sync Mates trimmed/filtered independently Process pairs together (cutadapt -p; Trimmomatic paired outputs)
Small-RNA yields huge "reads" Forgot --discard-untrimmed / length gate Add --discard-untrimmed -m 18 -M 30
3' G-content rise persists after trimming 2-color poly-G is high-quality, not adapter cutadapt --nextseq-trim or fastp auto poly-G
Half of R2 disappears in Trimmomatic keepBothReads default False drops redundant R2 Add keepBothReads (True) if both mates are needed downstream

References

Martin M. 2011. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal 17(1):10-12. Bolger AM, Lohse M, Usadel B. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30(15):2114-2120. MacManes MD. 2014. On the optimal trimming of high-throughput mRNA sequence data. Frontiers in Genetics 5:13. Williams CR, Baccarella A, Parrish JZ, Kim CC. 2016. Trimming of sequence reads alters RNA-Seq gene expression estimates. BMC Bioinformatics 17:103. Chen S, Zhou Y, Chen Y, Gu J. 2018. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34(17):i884-i890.

Related Skills

read-qc/quality-reports - Read the adapter-content panel that triggers trimming read-qc/quality-filtering - Quality and length filtering after adapter removal read-qc/fastp-workflow - All-in-one adapter + quality trim with auto poly-G read-qc/contamination-screening - k-mer removal of PhiX/vector/contaminant sequence small-rna-seq/smrna-preprocessing - Full small-RNA adapter + length workflow read-alignment/bwa-alignment - Soft-clipping aligner that handles low-quality tails without trimming