smithery.ai

bio-primer-design-primer-validation

Validates chosen PCR/qPCR oligos for intramolecular thermodynamic liabilities with primer3-py - hairpins, self-dimers, cross-dimers (calc_hairpin/homodimer/heterodimer), and 3'-end stability (calc_end_stability) - returning ThermoResult dG/Tm and ASCII structures. Covers why a "dimer-free" verdict is a PREDICTION at the supplied salt/Mg/dNTP/oligo conditions and temp_c (so the same primer is fine or dimer-prone depending on conditions), why a 3'-END dimer or hairpin is the lethal class (polymer…

First seen Apr 12, 2026

Installation

$ npx skills add https://smithery.ai

Summary

  • Validates chosen PCR/qPCR oligos for intramolecular thermodynamic liabilities with primer3-py - hairpins, self-dimers, cross-dimers (calc_hairpin/homodimer/heterodimer), and 3'-end stability (calc_end_stability) - returning ThermoResult dG/Tm and ASCII structures.
  • Covers why a "dimer-free" verdict is a PREDICTION at the supplied salt/Mg/dNTP/oligo conditions and temp_c (so the same primer is fine or dimer-prone depending on conditions), why a 3'-END dimer or hairpin is the lethal class (polymerase-extendable into primer-dimer) so structures are ranked by dG at the annealing temperature and 3'-end involvement rather than global Tm, that ThermoResult dG is in cal/mol not kcal/mol, and that .structure_found must gate the numbers.
  • Use when checking primer pairs before ordering, troubleshooting primer-dimers or smears, or screening oligos for secondary structure.
  • Genome off-target/mispriming is primer-specificity; design is primer-basics; probe assays are qpcr-primers.

Similar popular skills

Related neighbors and high-traction skills in the same topics — useful to compare before installing.

Also in this package

Other skills from smithery.ai · top by installs.

npx skills add https://smithery.ai

Browse all from smithery.ai

More details

Agent compatibility

Declared targets from SKILL.md / docs. Unmarked agents are not listed — the skill may still install via the CLI.

Claude Code Not declared
Cursor Not declared
Codex Not declared
GitHub Copilot Not declared
Windsurf Not declared
Gemini CLI Not declared
Cline Not declared
OpenCode Not declared

Package contents

Files included with this skill beyond the listing page.

  • skill md SKILL.md 14,238 B
  • docs SUMMARY.md 292 B

History

  1. First seen on skills.sh
  2. First recorded snapshot · 1 installs

SKILL.md

Version Compatibility

Reference examples tested with: primer3-py 2.3+.

Before using code patterns, verify installed versions match. If versions differ:

  • Python: pip show primer3-py then help(primer3.calc_heterodimer) to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

Primer Validation -- Thermodynamic Self-Structure of the Chosen Oligos

"Are these primers free of dimers and hairpins?" -> Predict the most stable intramolecular and inter-primer structures and judge them at the reaction conditions -- because a structure's harm is set by its dG at the annealing temperature and by whether it ties up the 3' end, not by a single global score.

  • Python: primer3.calchairpin(seq), calchomodimer(seq), calcheterodimer(seq1, seq2), calcendstability(seq1, seq2) return a ThermoResult with .tm, .dg, .structurefound.

Scope: thermodynamic validation of the OLIGOS themselves (hairpin, homodimer, heterodimer, 3'-end stability, pair Tm match) under stated conditions. Genome-wide off-target / mispriming / in-silico PCR -> primer-specificity. Designing primers -> primer-basics. qPCR primer+probe co-design -> qpcr-primers.

The Single Most Important Modern Insight -- A "Dimer-Free" Verdict Is a Prediction at the Conditions Supplied, and the 3' End Is What Kills the Reaction

  1. These are predictions, not facts. calchairpin/calchomodimer/calcheterodimer compute a dG/Tm under a specific monovalent/divalent/dNTP/oligo concentration and an evaluation temperature (tempc). The same primer can read "fine" at default 37 C / default salt and "dimer-prone" at the real annealing temperature and Mg2+. Validate at the conditions and temp_c of the actual reaction, or the verdict is decorative.
  2. The 3' end is the lethal locus. A dimer or hairpin that pairs the primer's 3' end is polymerase-EXTENDABLE: it gets turned into primer-dimer that amplifies exponentially, consumes reagents, and (in SYBR qPCR) generates competing signal. A structure with a more negative GLOBAL dG but a free 3' end is far less harmful. So do NOT rank by global dG or global Tm -- inspect 3'-end involvement (calcendstability and the ASCII structure) and judge at the annealing temperature.
  3. Read the units and the gate. ThermoResult.dg, .dh are in cal/mol (and .ds in cal/(K.mol)) -- a value of -6000 is -6 kcal/mol, so divide by 1000 before comparing to kcal/mol heuristics. Always check .structure_found first: if no structure formed, the .tm/.dg are not a real duplex.

The Three Structures, and Why They Differ

  • Hairpin (intramolecular): the primer folds on itself; harmful mainly when it sequesters the 3' end or raises effective Tm enough to block template annealing.
  • Homodimer (self-dimer): two copies of one primer pair; common with self-complementary or palindromic primers.
  • Heterodimer (cross-dimer): the forward and reverse primers pair with each other. A primer can be individually clean and still cross-dimer with its partner, so the pair must be checked explicitly -- this is the dimer most often missed.

Tool Taxonomy

Function Citation Mechanism / role When
calc_hairpin(seq) Untergasser 2012 Nucleic Acids Res 40:e115 most stable self-fold via thermodynamic alignment (ntthal) screen a single primer/probe for hairpins
calc_homodimer(seq) Untergasser 2012 Nucleic Acids Res 40:e115 most stable self-self duplex self-dimer of one oligo
calc_heterodimer(s1, s2) Untergasser 2012 Nucleic Acids Res 40:e115 most stable cross duplex of two oligos forward-vs-reverse (and probe) cross-dimer
calcendstability(s1, s2) SantaLucia & Hicks 2004 Annu Rev Biophys 33:415 dG of the 3' end of s1 annealing to s2 the 3'-anchored, extendable-dimer question
calc*tm (float) Untergasser 2012 Nucleic Acids Res 40:e115 the .tm only, no structure object fast high-throughput screening
calc_tm(seq) SantaLucia 1998 PNAS 95:1460 nearest-neighbor Tm vs perfect complement the pair Tm-match check

Decision Tree by Scenario

Scenario Recommended Why
Standard pre-order check of a pair calchairpin/homodimer on each + calcheterodimer on the pair, at reaction conditions and temp_c = Ta the four-call panel that catches self-structure
Suspect a primer-dimer artifact (gel, low-Tm melt peak) calcheterodimer + calcend_stability, read the ASCII structure for 3'-end pairing 3'-end dimers are extendable; that is the artifact source. A dimer that appears only at LOW template is diagnostic -- with scarce target, primer-primer collisions win the kinetic competition
Screening hundreds of oligos calchairpintm/calchomodimertm (floats) fast triage; promote flagged ones to full ThermoResult
One primer designed with a 5' tail run the calls on the FULL tailed oligo the tail exists physically (palindromic sites/Gibson arms dimerize)
Pair anneals unevenly / one strand dominates compare calc_tm of the two primers a Tm mismatch >2-3 C, not a dimer, is the cause
"Will it amplify only the target?" -> primer-specificity that is genome off-target, a different question and toolset

Default when uncertain: run the four-call panel at the real salt/Mg/dNTP/oligo concentrations with temp_c set to the annealing temperature, flag any structure whose dG is strongly negative at Ta, and weight 3'-end involvement most.

Validate a Primer Pair at Reaction Conditions

Goal: Decide whether a chosen forward/reverse pair will misbehave through hairpins or dimers in the actual reaction, with the 3' end weighted appropriately.

Approach: Run hairpin and homodimer on each primer and heterodimer on the pair, all at the reaction's salt/Mg/dNTP/oligo concentrations and with tempc set to the annealing temperature; gate every result on .structurefound; additionally compute calcendstability on the heterodimer to expose 3'-anchored (extendable) dimers; compare the two primer Tms for a match.

import primer3

fwd, rev = 'GTCTCCTCTGACTTCAACAGCG', 'ACCACCCTGTTGCTGTAGCCAA'
COND = dict(mv_conc=50.0, dv_conc=3.0, dntp_conc=0.8, dna_conc=250.0, temp_c=60.0)  # match the qPCR/PCR reaction + Ta

def flag(label, res):
    if res.structure_found:
        print(f'{label}: Tm={res.tm:.1f}C dG={res.dg/1000:.2f} kcal/mol')   # dg is cal/mol -> /1000
    else:
        print(f'{label}: no structure')

for name, seq in [('fwd', fwd), ('rev', rev)]:
    flag(f'{name} hairpin', primer3.calc_hairpin(seq, **COND))
    flag(f'{name} homodimer', primer3.calc_homodimer(seq, **COND))

flag('heterodimer', primer3.calc_heterodimer(fwd, rev, **COND))
end = primer3.calc_end_stability(fwd, rev, **COND)            # 3'-end-anchored stability = the extendable-dimer risk
print(f"3'-end stability dG={end.dg/1000:.2f} kcal/mol")

dtm = abs(primer3.calc_tm(fwd, **{k: COND[k] for k in ('mv_conc','dv_conc','dntp_conc','dna_conc')})
          - primer3.calc_tm(rev, **{k: COND[k] for k in ('mv_conc','dv_conc','dntp_conc','dna_conc')}))
print(f'pair Tm difference={dtm:.1f}C')

Reading the Result: dG, the 3' End, and the Structure

ThermoResult.dg is in cal/mol (divide by 1000 for kcal/mol). More negative = more stable = more concerning. But two structures with similar Tm can have very different dG at the annealing temperature, and the structure's own Tm is just where its dG crosses zero -- so judge by dG at tempc = Ta, not by Tm. Print res.asciistructure (or res.asciistructurelines) to SEE where the duplex sits: a dimer that pairs the recessed 3' ends is extendable and disqualifying even at modest dG, while a stronger structure with free 5'/internal pairing only transiently lowers free primer. calcendstability(fwd, rev) isolates exactly the 3'-end-of-fwd-against-rev stability, which is the right number for "will this dimer extend." It scores the 3' end of the FIRST argument, so check both directions (also calcendstability(rev, fwd)) -- either primer's 3' end can anchor the extendable dimer.

Per-Method Failure Modes

Ranking dimers by global dG or Tm

Trigger: Accepting/rejecting a structure on its overall dG or Tm. Mechanism: a weak dimer that locks the 3' ends is extended into artifact, while a strong dimer with free 3' ends is benign. Symptom: a "passing" pair still produces primer-dimer; a "failing" pair amplifies fine. Fix: inspect 3'-end involvement (calcendstability, ASCII structure) and weight it above whole-molecule dG.

Validating at the wrong temperature/conditions

Trigger: Using default tempc=37 and default salt instead of the reaction's Ta and Mg2+. Mechanism: structure stability is strongly condition-dependent; a structure that melts below Ta is harmless. Symptom: false alarms (or false passes) that do not match the bench. Fix: set tempc to the annealing temperature and pass the real mv/dv/dntp/dna concentrations.

Trusting dG without a structure

Trigger: Reading .dg/.tm without checking .structurefound. Mechanism: when no structure forms the fields are not a real duplex. Symptom: nonsense or contradictory numbers. Fix: gate every result on .structurefound before reporting.

Unit confusion (cal vs kcal)

Trigger: Comparing .dg directly to a kcal/mol threshold. Mechanism: primer3-py reports dG in cal/mol, so -6000 is -6 kcal/mol. Symptom: thresholds off by 1000x; everything looks catastrophic or fine. Fix: divide .dg by 1000 before comparing.

Validating only the binding core of a tailed primer

Trigger: Checking the template-binding portion of a primer that carries a 5' tail. Mechanism: the full oligo (tail included) is what physically exists; palindromic restriction sites and complementary Gibson arms dimerize. Symptom: clean validation, dimers on the bench. Fix: run the calls on the FULL tailed oligo.

Quantitative Thresholds

These are FLAGGING heuristics for inspection, not hard cutoffs; they are condition-dependent (salt, Mg2+, primer concentration, Ta). Read the structure and judge at Ta before accepting or rejecting.

Threshold Source Rationale
Hairpin Tm at least ~10 C below Ta SantaLucia & Hicks 2004 Annu Rev Biophys 33:415 a hairpin that melts well below the anneal step is largely denatured
Dimer dG flag if more negative than ~ -6 to -9 kcal/mol -- common practice line; below ~ -9 generally rejected; condition-dependent
3'-END dimer dG: be stricter, flag ~ -3 to -5 kcal/mol Kwok 1990 Nucleic Acids Res 18:999 3'-anchored dimers are extendable, so weight them above global dG
Pair Tm difference <= 2 C Koressaar & Remm 2007 Bioinformatics 23:1289 matched Tm so both primers anneal at one Ta
Evaluate at temp_c = annealing temperature SantaLucia & Hicks 2004 Annu Rev Biophys 33:415 dG at Ta, not at 37 C, is the harm-relevant quantity

Common Errors

Error / symptom Cause Solution
AttributeError: calcHeterodimer camelCase deprecated since primer3-py 1.0.0 use snakecase calcheterodimer
Validation disagrees with the bench default temp_c/salt, not the real reaction pass reaction mv/dv/dntp/dna and temp_c = Ta
A "clean" pair still makes primer-dimer judged by global dG, missed the 3' end check calcendstability and the ASCII structure
dG threshold seems 1000x off .dg is cal/mol, not kcal/mol divide by 1000 before comparing
.tm/.dg look meaningless no structure formed gate on .structure_found
Pair amplifies one strand only Tm mismatch, not a dimer compare calc_tm of the two primers; redesign Tm-matched (primer-basics)

References

  • Untergasser A, Cutcutache I, Koressaar T, et al. 2012. Primer3 - new capabilities and interfaces. Nucleic Acids Res 40:e115.
  • SantaLucia J Jr, Hicks D. 2004. The thermodynamics of DNA structural motifs. Annu Rev Biophys Biomol Struct 33:415-440.
  • SantaLucia J Jr. 1998. A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. PNAS 95:1460-1465.
  • Koressaar T, Remm M. 2007. Enhancements and modifications of primer design program Primer3. Bioinformatics 23:1289-1291.
  • Kwok S, Kellogg DE, McKinney N, et al. 1990. Effects of primer-template mismatches on the polymerase chain reaction: human immunodeficiency virus type 1 model studies. Nucleic Acids Res 18:999-1005.

Related Skills

  • primer-basics - Design Tm-matched primer pairs (redesign if validation fails)
  • primer-specificity - Genome-wide off-target / in-silico PCR (a different question)
  • qpcr-primers - Co-design qPCR primers and probes, including probe self-structure
  • sequence-manipulation/seq-objects - Reverse-complement and assemble tailed oligos to validate